shRNA载体质粒plko.1 mannual

《shRNA载体质粒plko.1 mannual》由会员分享，可在线阅读，更多相关《shRNA载体质粒plko.1 mannual（17页珍藏版）》请在装配图网上搜索。

1、peteadam@　　　 2013/1/8　　 pLKO.1 – TRC Cloning Vector　 Addgene Plasmid 10878. Protocol Version 1.0. December 2006.　　　 Copyright Addgene 2006, All Rights Reserved. This protocol is provided for your convenience. See “warranty information” in appendix. 　　 Table of Contents 　 A. pLKO.1-TRC Cloning

2、 Vector 　　　 A.1 The RNAi Consortium 　 A.2 Map of pLKO.1 　 A.3 Related plasmids 　　　 B. Designing shRNA Oligos for pLKO.1 　 B.1 Determine the optimal 21-mer targets in your gene 　　 B.2 Order oligos compatible with pLKO.1 　　　 C. Cloning shRNA oligos into pLKO.1 　　 C.1 Recommended materi

3、als 　　　 C.2 Annealing oligos 　　　 C.3 Digesting pLKO.1 TRC-Cloning Vector 　　　 C.4 Ligating and transforming into bacteria 　　 D. Screening for Inserts 　 D.1 Recommended materials 　 D.2 Screening for inserts 　　　 E. Producing Lentiviral Particles 　 E.1 Recommended materials 　　 E.2 Prot

4、ocol for producing lentiviral particles 　 F. Infecting Target Cells 　　　 F.1 Recommended materials 　　　 F.2 Determining the optimal puromycin concentration 　 F.3 Protocol for lentiviral infection and selection 　　　 G. Safety 　 H. References 　　　 H.1 Published articles 　　 H.2 Web resource

5、s 　　　 I. Appendix 　　　 I.1 Sequence of pLKO.1 TRC-Cloning Vector 　 I.2 Recipes 　　 I.3 Warranty information 　　 Back to Top　　 A. pLKO.1-TRC Cloning Vector　　 A.1 The RNAi Consortium　　 The pLKO.1 cloning vector is the backbone upon which The RNAi Consortium has built a library of shRNAs direc

6、ted against 15,000 human and 15,000 mouse genes. Addgene is working with the TRC to make this shRNA cloning vector available to the scientific community. Please cite Moffat et al., Cell 2006 Mar; 124(6):1283-98 (PubMed”:http://www.ncbi.nlm.nih.gov/pubmed/16564017?dopt=abstract) in all publications a

7、rising from the use of this vector.　 A.2 Map of pLKO.1　 pLKO.1 is a replication-incompetent lentiviral vector chosen by the TRC for expression of shRNAs. pLKO.1 can be introduced into cells via direct transfection, or can be converted into lentiviral particles for subsequent infection of a target

8、cell line. Once introduced, the puromycin resistance marker encoded in pLKO.1 allows for convenient stable selection. 　　　 　 Figure 1 : Map of pLKO.1 containing an shRNA insert. The original pLKO.1-TRC cloning vector has a 1.9kb stuffer that is released by digestion with AgeI and EcoRI. shRNA oligo

9、s are cloned into the AgeI and EcoRI sites in place of the stuffer. The AgeI site is destroyed in most cases (depending on the target sequence), while the EcoRI site is preserved. For a complete map of pLKO.1 containing the 1.9kb stuffer, visit www.addgene.org/10878. 　　 Description　 Vector Element

10、 　　　 U6 　　 Human U6 promoter drives RNA Polymerase III transcription for generation of shRNA transcripts. 　　 cPPT 　　　 Central polypurine tract, cPPT, improves transduction efficiency by facilitating nuclear import of the vector’s preintegration complex in the transduced cells. 　 hPGK 　 Human p

11、hosphoglycerate kinase promoter drives expression of puromycin. 　 Puro R 　　　 Puromycin resistance gene for selection of pLKO.1 plasmid in mammalian cells. 　　 sin 3’LTR 　　 3’ Self-inactivating long terminal repeat. 　　　 f1 ori 　　 f1 bacterial origin of replication. 　　　 Amp R 　　 Ampicillin resi

12、stance gene for selection of pLKO.1 plasmid in bacterial cells 　 pUC ori 　 pUC bacterial origin of replication. 　 5’LTR 　 5’ long terminal repeat. 　　　 RRE 　　　 Rev response element. 　　　 　　　 A.3 Related Products　 The following plasmids available from Addgene are recommended for use in conjunc

13、tion with the pLKO.1 TRC-cloning vector. 　 Plasmid (Addgene ID #) 　　 Description 　 pLKO.1 – TRC control 　 Negative control vector containing non-hairpin insert. 　　 pLKO.1 – scramble shRNA 　　　 Negative control vector containing scrambled shRNA. 　　　 psPAX2 　 Packaging plasmid for producing vir

14、al particles. 　　 pMD2.G 　 Envelope plasmid for producing viral particles. 　 Note: pLKO.1 can also be used with packaging plasmid pCMV-dR8.2 dvpr and envelope plasmid pCMV-VSVG from Robert Weinberg’s lab. For more information, visit Addgene’s Mammalian RNAi Tools page.　　 Several other laboratorie

15、s have deposited pLKO derived vectors that may also be useful for your experiment. To see these vectors, visit Addgene’s website and “search for “pLKO”“.　　 Back to Top　　　 B. Designing shRNA Oligos for pLKO.1　 B.1 Determining the Optimal 21-mer Targets in your Gene　　 Selection of suitable 21-mer

16、targets in your gene is the first step toward efficient gene silencing. Methods for target selection are continuously being improved. Below are suggestions for target selection.　　　 1. Use an siRNA selection tool to determine a set of top-scoring targets for your gene. For example, the Whitehead Ins

17、titute for Biomedical Research hosts an siRNA Selection Program that can be accessed after a free registration (http://jura.wi.mit.edu/bioc/siRNAext/). If you have MacOS X, another excellent program is iRNAi, which is provided free by the company Mekentosj ( 　　　 A summary of guidelines for designin

18、g siRNAs with effective gene silencing is included here:　　 Starting at 25nt downstream of the start codon (ATG), search for 21nt sequences that match the pattern AA(N 19 ). If no suitable match is found, search for NAR(N 17 )YNN, where N is any nucleotide, R is a purine (A,G), and Y is a pyrimidin

19、e (C,U). 　　 G-C content should be 36-52%. 　　　 Sense 3’ end should have low stability – at least one A or T between position 15-19. 　　　 Avoid targeting introns. 　　　 Avoid stretches of 4 or more nucleotide repeats, especially repeated Ts because polyT is a termination signal for RNA polymerase

20、 III. 　 2. To minimize degradation of off-target mRNAs, use NCBI’s BLAST program. Select sequences that have at least 3 nucleotide mismatches to all unrelated genes. 　　 Addgene recommends that you select multiple target sequences for each gene. Some sequences will be more effective than others. In

21、 addition, demonstrating that two different shRNAs that target the same gene can produce the same phenotype will alleviate concerns about off-target effects. 　　　 B.2 Ordering Oligos Compatible with pLKO.1　　　 To generate oligos for cloning into pLKO.1, insert your sense and antisense sequences from

22、 step B.1 into the oligos below. Do not change the ends; these bases are important for cloning the oligos into the pLKO.1 TRC-cloning vector.　 Forward oligo:　　　 5’ CCGG—21bp sense—CTCGAG—21bp antisense—TTTTTG 3’　 Reverse oligo:　 5’ AATTCAAAAA—21bp sense—CTCGAG—21bp antisense 3’　　　 For example,

23、if the target sequence is (AA)TGCCTACGTTAAGCTATAC, the oligos would be:　 Forward oligo: 　　 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’　　 Reverse oligo:　 5’ AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT 3’ 　 Back to Top　 C. Cloning Oligos into pLKO.1　　　

24、 The pLKO.1-TRC cloning vector contains a 1.9kb stuffer that is released upon digestion with EcoRI and AgeI.　 The oligos from section B contain the shRNA sequence flanked by sequences that are compatible with the sticky ends of EcoRI and AgeI. Forward and reverse oligos are annealed and ligated int

25、o the pLKO.1 vector, producing a final plasmid that expresses the shRNA of interest.　　 C.1 Recommended Materials　　 Material 　　 Vendor and catalog # 　　 AgeI 　 New England Biolabs (NEB) #R0552S 　 EcoRI 　 NEB #R0101S 　　　 T4 DNA ligase 　　　 NEB #M0202S 　 NEB buffer 2 　　 NEB #B7002S 　　 DH5 alp

26、ha competent cells 　　　 Invitrogen #18258-012 　 Qiaquick gel extraction kit 　　 Qiagen #28704 　 Low melting point agarose 　　 Sigma #A9414 　　 Luria Broth Agar (LB agar) 　 American Bioanalytical: #AB01200-02000 　　 Ampicillin 　　　 VWR: #7177-48-2. Use at 100 μg/mL. 　　 Carbenicillin 　　　 VWR: #80

27、030-956. Use at 100 μg/mL. 　　 C.2 Annealing Oligos　　　 1. Resuspend oligos in ddH2O to a concentration of 20 μM, then mix:　　 5 μL Forward oligo 5 μL Reverse oligo 5 μL 10x NEB buffer 2 35 μL ddH2O　 2. Incubate for 4 minutes at 95C in a PCR machine or in a beaker of boiling water.　　　 3. If usi

28、ng a PCR machine, incubate the sample at 70C for 10 minutes then slowly cool to room temperature over the period of several hours. If using a beaker of water, remove the beaker from the flame, and allow the water to cool to room temperature. This will take a few hours, but it is important for the co

29、oling to occur slowly for the oligos to anneal. 　　　 C.3 Digesting pLKO.1 TRC Cloning Vector　 1. Digest pLKO.1 TRC-cloning vector with AgeI. Mix:　　 6 μg pLKO.1 TRC-cloning vector (maxiprep or miniprep DNA) 5 μL 10x NEB buffer 1 1 μL AgeI to 50 μL ddH2O　　　 > Incubate at 37C for 2 hours. 　　 2.

30、Purify with Qiaquick gel extraction kit. Elute in 30 μL of ddH2O.　 3. Digest eluate with EcoRI. Mix:　 30 μL pLKO.1 TRC-cloning vector digested with AgeI 5 μL 10x NEB buffer for EcoRI 1 μL EcoRI 14 μL ddH2O　 > Incubate at 37C for 2 hours. 　　　 4. Run digested DNA on 0.8% low melting point agaro

31、se gel until you can distinctly see 2 bands, one 7kb and one 1.9kb. Cut out the 7kb band and place in a sterile microcentrifuge tube.　 When visualizing DNA fragments to be used for ligation, use only long-wavelength UV light. Short wavelength UV light will increase the chance of damaging the DNA. 　

32、 5. Purify the DNA using a Qiaquick gel extraction kit. Elute in 30 μL of ddH2O.　 6. Measure the DNA concentration. 　　 C.4 Ligating and Transforming into Bacteria　　　 1. Use your ligation method of choice. For a standard T4 ligation, mix:　 2 μL annealed oligo from step C.2. 20 ng digested pLKO.

33、1 TRC-cloning vector from step C.3. (If you were unable to measure the DNA concentration, use 1 μL) 2 μL 10x NEB T4 DNA ligase buffer 1 μL NEB T4 DNA ligase to 20 μL ddH2O　 > Incubate at 16C for 4-20 hours. 　　　 2. Transform 2 μL of ligation mix into 25 μL competent DH5 alpha cells, following ma

34、nufacturer’s protocol. Plate on LB agar plates containing 100 μg/mL ampicillin or carbenicillin (an ampicillin analog).　 Back to Top　　 D. Screening for Inserts　　 You may screen for plasmids that were successfully ligated by restriction enzyme digestion. However, once you have identified the posit

35、ive clones, it is important to verify the insert by conducting a sequencing reaction.　　　 D.1 Recommended Materials　 Material 　　　 Vendor and catalog # 　　 DNA Miniprep Kit 　　 Qiagen #27104 　　 EcoRI 　 NEB #R0101S 　 NcoI 　 NEB #R0193S 　　　 Agarose 　 Sigma #A9539 　 D.2 Screening for Inserts　　　

36、 Day 1:　　　 1. Innoculate 5 colonies from each ligation into LB + 100 μg/mL ampicillin or carbenicillin. 　 Day 2:　　　 2. Spin down the cultures and use a miniprep kit to obtain DNA.　　　 3. Conduct a restriction digest with EcoRI and NcoI: 　 1 μg miniprep DNA 　 2 μL 10x NEB buffer for EcoRI 　　

37、 0.8 μL EcoRI 　 0.8 μL NcoI 　　　 to 20 μL ddH2O 　 > Incubate at 37C for 1-2 hours. 　　　 4. Run the digestion products on a 1% agarose gel. You should see two fragments, a 2kb fragment and a 5kb fragment.　　 5. Sequence positive clones with pLKO.1 sequencing primer (5’ CAA GGC TGT TAG AGA GAT AA

38、T TGG A 3’).　　　 You may need to adjust the sequencing conditions if the DNA polymerase has difficulty reading through the secondary structure of the hairpin sequence. 　　 Back to Top　 E. Producing Lentiviral Particles 　　　 Before this step, you must contact your institution’s Bio-Safety office to

39、receive permission and institution-specific instructions. You must follow safety procedures and work in an environment (e.g. BL2+) suitable for handling HIV-derivative viruses.　 For transient knockdown of protein expression, you may transfect plasmid DNA directly into the target cells. The shRNA wi

40、ll be expressed, but the DNA is unlikely to be integrated into the host genome.　 For stable loss-of-function experiments, Addgene recommends that you generate lentiviral particles and infect the target cells. Addition of puromycin will allow you to select for cells that stably express your shRNA of

41、 interest. 　　　 E.1 Recommended Materials　 Material 　　 Vendor and catalog # 　　　 psPAX2 　　 Addgene #12260 　 pMD2.G 　 Addgene #12259 　　 HEK-293T cells 　　　 GenHunter: #Q401 　　 FuGENE 6 Transfection Reagent 　　 Roche Applied Biosciences: #11814443001 　 OPTI-MEM serum-free media 　　 Invitrogen:

42、 #31985 　　 Dulbecco’s Modified Eagle Medium (DMEM) 　 Invitrogen: #11995 　　 Fetal Bovine Serum (FBS) 　　　 Invitrogen: #16000 　 Penicillin/Streptomycin 　　 Invitrogen: #15140-122 　　　 Polypropylene tubes 　 VWR: #87003-290 　　 Note: pLKO.1 could also be packaged using pCMV-dR8.2 dvpr and pCMV-VSVG

43、 from the Robert Weinberg lab. For more information, visit Addgene’s Mammalian RNAi Tools page.　　 E.2 Protocol for Producing Lentiviral Particles　　　 This protocol is for transfection in a 6 cm plate. The protocol can be scaled to produce different amounts of virus as needed. 　　 Day 1:　 a. For ea

44、ch plasmid to be transfected, plate 7105 HEK-293T cells in 5 mL of media in a 6 cm tissue culture plate. Incubate cells at 37oC, 5% CO2 overnight.　　 Although cells should regularly be passaged in DMEM + 10% FBS with penicillin/streptomycin, cells should be plated at this step in DMEM + 10% FBS with

45、out antibiotics (no penicillin or streptomycin). 　　　 Day 2:　 b. Perform the transfection in the late afternoon because the transfection mix should only be incubated with the cells for 12-15 hours.　 c. In polypropylene microfuge tubes (do NOT use polystyrene tubes), make a cocktail for each transf

46、ection: 　 1 μg pLKO.1 shRNA plasmid 　　　 750 ng psPAX2 packaging plasmid 　 250 ng pMD2.G envelope plasmid 　　　 to 20 μl serum-free OPTI-MEM 　　　 You may want to vary the ratio of shRNA plasmid, packaging plasmid, and envelope plasmid to obtain the ratio that gives you the optimal viral product

47、ion. 　 d. Create a master mix of FuGENE 6 transfection reagent in serum-free OPTI-MEM. Calculate the amount of Fugene and OPTI-MEM necessary given that each reaction will require 6 μL FuGENE + 74 μL OPTI-MEM. For example:　　　 1x master mix: 6 μL FuGENE + 74 μL OPTI-MEM 　　 5x master mix: 30 μL Fu

48、GENE + 370 μL OPTI-MEM 　 10x master mix: 60 μL FuGENE + 740 μL OPTI-MEM 　　　 In a polypropylene tube, add OPTI-MEM first. Pipette FuGENE directly into the OPTI-MEM – do not allow FuGENE to come in contact with the walls of the tube before it has been diluted. Mix by swirling or gently flicking the

49、 tube. Incubate for 5 minutes at room temperature.　　 e. Add 80 μL of FuGENE master mix to each tube from step c for a total volume of 100 μL. Pipette master mix directly into the liquid and not onto the walls of the tube. Mix by swirling or gently flicking the tube.　　 f. Incubate for 20-30 minutes

50、 at room temperature.　　 g. Retrieve HEK-293T cells from incubator. The cells should be 50-80% confluent and in DMEM that does not contain antibiotics.　　　 h. Without touching the sides of the dish, gently add DNA:FuGENE mix dropwise to cells. Swirl to disperse mixture evenly. Do not pipette or swir

51、l too vigorously, as you do not want to dislodge the cells from the plate.　　 i. Incubate cells at 37C, 5% CO2 for 12-15 hours. 　　　 Day 3:　 j. In the morning, change the media to remove the transfection reagent. Replace with 5 mL fresh DMEM + 10% FBS + penicillin/streptomycin. Pipette the media on

52、to the side of the plate so as not to disturb the transfected cells.　 k. Incubate cells at 37C, 5% CO2 for 24 hours. 　　 Day 4:　 l. Harvest media from cells and transfer to a polypropylene storage tube. The media contains your lentiviral particles. Store at 4C.　 m. Add 5 mL of fresh media contain

53、ing antibiotics to the cells and incubate at 37C, 5% CO2 for 24 hours. 　　　 Day 5:　 n. Harvest media from cells and pool with media from Day 4. Spin media at 1,250 rpm for 5 minutes to pellet any HEK-293T cells that were inadvertently collected during harvesting.　　　 In lieu of centrifugation, you

54、may filter the media through a 0.45 μm filter to remove the cells. Do not use a 0.2 μm filter, as this is likely to shear the envelope of your virus. 　　　 o. Virus may be stored at 4C for a few days, but should be frozen at -20C or -80C for long-term storage.　 Freeze/thaw cycles decrease the effici

55、ency of the virus, so Addgene recommends that you use the virus immediately or aliquot the media into smaller tubes to prevent multiple freeze/thaw cycles. 　 Back to Top　　　 F. Infecting Target Cells　　　 Lentiviral particles can efficiently infect a broad range of cell types, including both dividin

56、g and non-dividing cells. Addition of puromycin will allow you to select for cells that are stably expressing your shRNA of interest.　　　 F.1. Recommended Materials　 Material 　　　 Vendor and catalog # 　 Hexadimethrine bromide (polybrene)* 　　　 Sigma-Aldrich: #H9268 　 Protamine Sulfate* 　　　 MP Bi

57、omedicals: #194729 　 Puromycin* 　　 Sigma-Aldrich: #P8833 　　 Target cells 　 Varies based on your experiment 　　　 Culture media for target cells 　　　 Varies based on your experiment 　 Materials for assay 　 Varies based on your experiment 　　　 Detailed protocols for preparing polybrene, protamin

58、e sulfate, and puromycin are located in the “Appendix”. 　　 F.2. Determining the Optimal Puromycin Concentration　　 Each cell line responds differently to puromycin selection. Addgene strongly recommends that you determine the optimal puromycin concentration for your cell line before initiating your

59、 experiment.　　 Day 1:　　 a. Plate target cells in ten 6 cm plates and grow at 37 C, 5% CO2 overnight. 　　 Day 2:　　 b. The target cells should be approximately 80-90% confluent.　 c. Dilute puromycin in the preferred culture media for your target cells. The final concentration of puromycin should b

60、e from 1-10 μg/mL in 1 μg/mL increments.　 d. Label plates from 1-10 and add appropriate puromycin-containing media to cells.　　　 Days 3+:　　 e. Examine cells each day and change to fresh puromycin-containing media every other day.　 f. The minimum concentration of puromycin that results in complete

61、 cell death after 3-5 days is the concentration that should be used for selection in your experiments. (You may wish to repeat this titration with finer increments of puromycin to determine a more precise optimal puromycin concentration.) 　　 F.3. Protocol for Lentiviral Infection and Selection　 Da

62、y 1:　 a. Plate target cells and incubate at 37C, 5% CO2 overnight. 　 Day 2:　　 b. Target cells should be approximately 70% confluent. Change to fresh culture media containing 8 μg/mL polybrene.　 Polybrene increases the efficiency of viral infection. However, polybrene is toxic to some cell lines.

63、 In these cell lines, substitute protamine sulfate for polybrene. 　 c. Add lentiviral particle solution from step E. For a 6 cm target plate, add between 0.05-1 mL virus (add ≥0.5 mL for a high MOI, and ≤0.1 mL for a low MOI). Scale the amount of virus added depending on the size of your target pla

64、te.　　　 MOI (multiplicity of infection) refers to the number of infecting viral particles per cell. Addgene recommends that you test a range of MOIs to determine the optimal MOI for infection and gene silencing in your target cell line. 　 d. Incubate cells at 37C, 5% CO2 overnight. 　 Day 3:　　　 e.

65、 Change to fresh media 24 hours after infection.　　 If viral toxicity is observed in your cell line, you may decrease the infection time to between 4 – 20 hours. Remove the virus-containing media and replace with fresh media. Do not add puromycin until at least 24 hours after infection to allow for

66、sufficient expression of the puromycin resistance gene. 　　 f. To select for infected cells, add puromycin to the media at the concentration determined in step E.2.　　 Addgene recommends that you maintain one uninfected plate of cells in parallel. This plate will serve as a positive control for the puromycin selection. 　 Days 4+:　 g. Change to fresh puromycin-containing media